Advertisement

Vocal fold fibroblasts promote angiogenesis in vocal fold leukoplakia by secreting pro-angiogenic factors

  • Author Footnotes
    1 These authors contributed equally to this work.
    Yinying Chu
    Footnotes
    1 These authors contributed equally to this work.
    Affiliations
    ENT Institute and Department of Otolaryngology-Head and Neck Surgery, Eye & ENT Hospital, Fudan University, 83 FenYang Road, Shanghai 200031, China
    Search for articles by this author
  • Author Footnotes
    1 These authors contributed equally to this work.
    Yi Fang
    Footnotes
    1 These authors contributed equally to this work.
    Affiliations
    ENT Institute and Department of Otolaryngology-Head and Neck Surgery, Eye & ENT Hospital, Fudan University, 83 FenYang Road, Shanghai 200031, China
    Search for articles by this author
  • Haitao Wu
    Affiliations
    ENT Institute and Department of Otolaryngology-Head and Neck Surgery, Eye & ENT Hospital, Fudan University, 83 FenYang Road, Shanghai 200031, China
    Search for articles by this author
  • Jian Chen
    Correspondence
    Corresponding authors.
    Affiliations
    ENT Institute and Department of Otolaryngology-Head and Neck Surgery, Eye & ENT Hospital, Fudan University, 83 FenYang Road, Shanghai 200031, China
    Search for articles by this author
  • Lei Cheng
    Correspondence
    Corresponding authors.
    Affiliations
    ENT Institute and Department of Otolaryngology-Head and Neck Surgery, Eye & ENT Hospital, Fudan University, 83 FenYang Road, Shanghai 200031, China
    Search for articles by this author
  • Author Footnotes
    1 These authors contributed equally to this work.
Open AccessPublished:May 02, 2022DOI:https://doi.org/10.1016/j.anl.2022.04.009

      Abstract

      Objective

      Cancer-associated fibroblasts (CAFs) have been reported to play an essential role in tumor angiogenesis and progression. In this study, we aimed to investigate the impact of vocal fold leukoplakia-associated fibroblasts (VFLFs) on the angiogenesis process in vocal fold leukoplakia (VFL) and their potential secretions of proangiogenic factors.

      Methods

      A total of 160 lesions (86 laryngeal carcinoma, 67 vocal fold leukoplakia, 7 vocal fold polyp) were detected under narrow band imaging (NBI) mode to evaluate the relationship between pathology and intraepithelial papillary capillary loop (IPCL) grades. We characterized immortalized vocal fold CAFs, VFLFs, normal fibroblasts (NFs) cell lines using immunofluorescence cytochemistry and real-time quantitative polymerase chain reaction (RT-qPCR). The effects of fibroblast conditioned media (CM) on the proliferative, migrating and tube formation capacity of human umbilical vein endothelial cells (HUVEC) were investigated using the cell counting kit-8 (CCK-8) assay, wound healing assay, transwell migration experiment and Matrigel tube formation experiment. The expression levels of proangiogenic factors in CAFs, VFLFs, and NFs were evaluated by antibody microarray and RT-qPCR.

      Results

      NBI images depicted that angiogenesis was abnormally activated during laryngeal tumorigenesis. Both CAF and VFLF expressed Vimentin, alpha-smooth muscle actin (α-SMA) and fibroblast activation protein (FAP). NF expressed Vimentin and α-SMA, but not FAP. The PCR results showed that mRNA expression levels of Vimentin, α-SMA and FAP in CAFs and VFLFs were significantly increased than those in NFs. CAF-CM and VFLF-CM promoted the proliferative, migrating, and tube formation ability of HUVECs. Secretome profiling of fibroblasts by antibody microarray demonstrated that VFLFs secreted significantly more vascular endothelial growth factor (VEGF), angiogenin, bFGF and HGF than NFs.

      Conclusions

      Overall, we demonstrated that VEGF, angiogenin, bFGF and HGF derived from VFLFs may play crucial roles in the angiogenesis process of laryngeal premalignant and malignant lesions. This may contribute to the exploitation of novel therapeutic strategies for VFL.

      Keywords

      1. Introduction

      Vocal fold leukoplakia (VFL) refers to the white plaque on the surface of vocal folds mucosa, considered the laryngeal precancerous condition [
      • Isenberg J.S.
      • Crozier D.L.
      • Dailey S.H.
      Institutional and comprehensive review of laryngeal leukoplakia.
      ]. Based on the grade of epithelial cell dysplasia, in 2017, WHO further dichotomized VFL into low-grade dysplasia and high-grade dysplasia, among which low-grade dysplasia includes non-dysplasia and mild dysplasia, and high-grade dysplasia includes moderate, severe dysplasia and carcinoma in situ [
      • Gale N.
      • Poljak M.
      • Zidar N.
      Update from the 4th edition of the world health organization classification of head and neck tumours: what is new in the 2017 WHO blue book for tumours of the hypopharynx, larynx, trachea and parapharyngeal space.
      ]. Multiple studies have demonstrated that the possibility of malignant progression appeared to increase with the degree of dysplasia [
      • Van Hulst A.M.
      • Kroon W.
      • van der Linden E.S.
      • Nagtzaam L.
      • Ottenhof S.R.
      • Wegner I.
      • et al.
      Grade of dysplasia and malignant transformation in adults with premalignant laryngeal lesions.
      ,
      • Lee D.H.
      • Yoon T.M.
      • Lee J.K.
      • Lim S.C.
      Predictive factors of recurrence and malignant transformation in vocal cord leukoplakia.
      ].
      Narrow band imaging (NBI) has a clearer presentation of submucosal blood vessels, which is helpful for the early detection of microvascular changes caused by invasion of malignant lesions and the prediction of the nature of vocal cord leukoplakia. To date, NBI has been extensively used in clinical practice. Ni et al. introduced a novel classification of superficial intraepithelial papillary capillary loop (IPCL) patterns under NBI for the higher accuracy in distinguishing benign and malignant VFL. Malignant leukoplakia is marked with large perpendicular brown dots, twisted, dilated, and branched vessels disorderly arranged [
      • Ni X.G.
      • Zhu J.Q.
      • Zhang Q.Q.
      • Zhang B.G.
      • Wang G.Q.
      Diagnosis of vocal cord leukoplakia: the role of a novel narrow band imaging endoscopic classification.
      ,
      • Ni X.G.
      • Wang G.Q.
      The role of narrow band imaging in head and neck cancer.
      ].
      Angiogenesis, the formation of new capillaries from existing blood vessels, regulated by the counterbalance between proangiogenic and antiangiogenic factors, is crucial for tumor growth, progression, and metastasis [
      • Hanahan D.
      • Folkman J.
      Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis.
      ,
      • Carmeliet P.
      • Jain R.K.
      Angiogenesis in cancer and other diseases.
      ]. Neovascularization is an intricate multistep process involving endothelial cell activation, proliferation, migration, lumen formation, vascular remodel, and stabilization [
      • Carmeliet P.
      • Jain R.K.
      Molecular mechanisms and clinical applications of angiogenesis.
      ]. Accumulated studies have revealed that the initiation of abnormal angiogenesis emerges in premalignant lesions, such as oral leukoplakia, laryngeal preneoplasia, and persists during carcinogenesis [
      • Hanahan D.
      • Folkman J.
      Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis.
      ,
      • Arora S.
      • Kaur J.
      • Sharma C.
      • Mathur M.
      • Bahadur S.
      • Shukla N.K.
      • et al.
      Stromelysin 3, Ets-1, and vascular endothelial growth factor expression in oral precancerous and cancerous lesions: correlation with microvessel density, progression, and prognosis.
      ,
      • Thiem D.G.E.
      • Schneider S.
      • Venkatraman N.T.
      • Kumar V.V.
      • Brieger J.
      • Frerich B.
      • et al.
      Semiquantifiable angiogenesis parameters in association with the malignant transformation of oral leukoplakia.
      ,
      • Laitakari J.
      • Näyhä V.
      • Stenbäck F.
      Size, shape, structure, and direction of angiogenesis in laryngeal tumour development.
      ].
      Increasing studies have suggested that, as one of the key components of the tumor microenvironment (TME), cancer-associated fibroblasts (CAF) play a vital role in facilitating pathological angiogenesis and tumorigenesis [
      • Kalluri R.
      The biology and function of fibroblasts in cancer.
      ]. Understanding how CAFs and tumor angiogenesis interact is favorable for developing novel tumor therapeutics. Previous studies have indicated that CAFs induce tumor angiogenesis by secreting proangiogenic factors and cytokines such as vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), platelet-derived growth factor (PDGF), placental growth factor (PlGF), stromal-derived factor-1 (SDF1), matrix metallopeptidase (MMP), Interleukin-6 (IL-6) [
      • Fukumura D.
      • Xavier R.
      • Sugiura T.
      • Chen Y.
      • Park E.C.
      • Lu N.
      • et al.
      Tumor induction of VEGF promoter activity in stromal cells.
      ,
      • Huang B.
      • Huang M.
      • Li Q.
      Cancer-associated fibroblasts promote angiogenesis of hepatocellular carcinoma by -mediated pathway.
      ,
      • Liu Z.
      • Chen M.
      • Zhao R.
      • Huang Y.
      • Liu F.
      • Li B.
      • et al.
      CAF-induced placental growth factor facilitates neoangiogenesis in hepatocellular carcinoma.
      ,
      • Orimo A.
      • Gupta P.B.
      • Sgroi D.C.
      • Arenzana-Seisdedos F.
      • Delaunay T.
      • Naeem R.
      • et al.
      Stromal fibroblasts present in invasive human breast carcinomas promote tumor growth and angiogenesis through elevated SDF-1/CXCL12 secretion.
      ,
      • Zhou B.
      • Zhuang X.M.
      • Wang Y.Y.
      • Lin Z.Y.
      • Zhang D.M.
      • Fan S.
      • et al.
      Tumor necrosis factor α induces myofibroblast differentiation in human tongue cancer and promotes invasiveness and angiogenesis via secretion of stromal cell-derived factor-1.
      ,
      • Eiro N.
      • González L.
      • Martínez-Ordoñez A.
      • Fernandez-Garcia B.
      • González L.O.
      • Cid S.
      • et al.
      Cancer-associated fibroblasts affect breast cancer cell gene expression, invasion and angiogenesis.
      ,
      • Mirkeshavarz M.
      • Ganjibakhsh M.
      • Aminishakib P.
      • Farzaneh P.
      • Mahdavi N.
      • Vakhshiteh F.
      • et al.
      Interleukin-6 secreted by oral cancer- associated fibroblast accelerated VEGF expression in tumor and stroma cells.
      ,
      • Ando N.
      • Hara M.
      • Shiga K.
      • Yanagita T.
      • Takasu K.
      • Nakai N.
      • et al.
      Eicosapentaenoic acid suppresses angiogenesis via reducing secretion of IL‑6 and VEGF from colon cancer‑associated fibroblasts.
      ,
      • Nagasaki T.
      • Hara M.
      • Nakanishi H.
      • Takahashi H.
      • Sato M.
      • Takeyama H.
      Interleukin-6 released by colon cancer-associated fibroblasts is critical for tumour angiogenesis: anti-interleukin-6 receptor antibody suppressed angiogenesis and inhibited tumour-stroma interaction.
      ]. However, there is no specific research on the contribution of vocal fold leukoplakia fibroblasts (VFLFs) to the premalignant angiogenesis process.
      The purpose of this study was to unravel the potential mechanism that regulated vascularization during malignant transformation of VFL. In the present study, we collected NBI pictures of 160 patients with laryngeal carcinoma, VFL, and vocal fold polyp to analyze the relationship between pathological diagnosis and IPCL grades. Then, we characterized CAFs, VFLFs and normal fibroblasts (NFs) using immunofluorescence cytochemistry and real-time quantitative polymerase chain reaction (RT-qPCR). CAFs and VFLFs enhanced angiogenesis by increasing HUVEC proliferation, migration, tube formation. We demonstrated that VEGF, angiogenin, HGF and bFGF were the major pro-angiogenic factors secreted by VFLFs using antibody microarray. Therefore, the identification of VEGF, angiogenin, HGF and bFGF may have important implications for therapeutics against vascular pattern alterations in VFL.

      2. Materials and methods

      2.1 Patients and cell lines

      This study was approved by the Ethics Committee of the Eye & ENT Hospital (approval number 2020014-1). Written informed consent form was obtained from all patients according to the Declaration of Helsinki. The protocol of the investigation has been approved by the Institutional Review Board.
      The NBI pictures were independently graded by 2 otolaryngologists and 1 endoscopist according to the 2019 Ni's IPCL grading standard [
      • Ni X.G.
      • Zhu J.Q.
      • Zhang Q.Q.
      • Zhang B.G.
      • Wang G.Q.
      Diagnosis of vocal cord leukoplakia: the role of a novel narrow band imaging endoscopic classification.
      ]. Type I: No IPCLs, but oblique, branch vessels are visible. Type II: Neither IPCL nor oblique, branch vessels can be observed. Type III: IPCLs can be observed on the mucosa of the vocal folds. Small brown spots are regularly arranged and exhibit unclear borders. Type IV: Large brown dots embed into the surface of the white patch. Type V: IPCLs appear on the vocal cords as large brown dots, located on the vocal fold mucosa outside the white patch, with a clear boundary. Type VI: Large brown dots or twisted neo-vessels are distributed not only on the surface of the leukoplakia, but also on the surface of the vocal fold mucosa outside the white patch.
      Primary fibroblasts were isolated from clinical specimens of vocal cord polyps, vocal cord leukoplakia (moderate and severe dysplasia), and laryngeal carcinoma. Subsequently, we immortalized the primary vocal fold fibroblasts by transfecting plasmid containing SV40 Large T genes, and named them NF, VFLF, CAF, respectively. The HUVEC cell line was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

      2.2 Preparation of CM

      The cells were then cultured in Dulbecco's modified eagle medium (DMEM, Gibco, Grand Island, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, Grand Island, USA), 1% penicillin-streptomycin in the 37 °C humidified incubator with 5% CO2.
      We prepared the CAF-, VFLF- and NF-CM by seeding fibroblasts (4 × 10 5cells/ml) into 10 cm cell culture dishes with 5 ml of high glucose DMEM containing 10% FBS (fetal bovine serum) and then incubated for an additional 72 h in 5 ml of serum-free DMEM. The supernatant was then collected and centrifuged at 4 °C, 1000g, 5 min, termed CAF-CM, VFLF-CM, NF-CM, respectively.

      2.3 Immunofluorescence Cytochemistry

      The fibroblasts were incubated on round glass slides placed in 24-well plates and fixed with 4% paraformaldehyde. Cells were permeabilized and blocked with blocking solution for 1 h. Then, the primary α-SMA antibody (1:500, ab#7817) and the Vimentin antibody (1:500, ab#92547) were added and the cells were incubated at 4 °C overnight. Then, the slides were rinsed in PBS and incubated with secondary antibody for 1 h. After rinsing, the cell nucleus was counterstained with 4′,6-diamidino-2-phenylindole (DAPI) and the slides were sealed with glycerol.

      2.4 Cell-Counting Kit-8 (CCK8) assay

      Cell proliferative ability was quantified with the CCK-8 assay kit (Dojindo, Tokyo, Japan). 2 × 103 cells were plated in each well of a 96-well plate and incubated with CM. At 24, 72 and 120 h, 10 μl of CCK-8 reagent was added and after culture for 1 h at 37 °C, the absorbance of each well was measured at 450 nm with a microplate reader (Bio-Rad, Richmond, USA). The cells of each group were analyzed for 5 replicates.

      2.5 In vitro cell migration assays

      For wound healing assay, 2 × 106 HUVECs were seeded in each well of 6-well plates. The monolayer was vertically scratched with 100 µL pipette tips. HUVECs were then incubated with serum-free CAF-CM, VFLF-CM and NF-CM, respectively. Photographs were acquired at 0 h, 24 h, and 48 h post-wounding in an inverted light microscope. The covered surface areas were analyzed by ImageJ software. For transwell migration assay, 2 × 104 HUVECs in 200 µl serum-free medium were placed into the upper chamber of the 24-well plate and 600 µl CM was added to the lower chamber. Cultured for 24 h at 37 °C, fixed with 4% paraformaldehyde and dyed with 1% crystal violet (Sangon Biotech, Shanghai, China). Next, wipe the cells in the upper chamber with a cotton swab and the cells that had passed through the membrane were photographed under a light microscope (Leica, Germany, magnification, × 200).

      2.6 Tube formation assay

      Tube formation assays were performed in 96-well plates coated with Matrigel matrix (BD Biosciences, CA) according to the manufacturer's instructions. HUVECs cultured with CAF-CM, VFLF-CM or NF-CM were incubated at 37 °C for 4 to 6 h. The images were captured using a light microscope (Leica, Germany) at 200 × magnification. The total branching length, the number of nodes and junctions, and the total mesh areas were analyzed using ImageJ software.

      2.7 Real-time quantitative polymerase chain reaction (RT-qPCR)

      Total RNA was extracted from CAFs, VFLFs, and NFs using TRIzol reagent (Invitrogen) as previously described. RT-qPCR was performed with TB Green Premix ExTaq (Takara, China) in the Applied Biosystems 7500 Fast Real-Time PCR System. The comparative Ct method (ΔCt) was applied to calculate relative expression levels. The mRNA expression levels were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primers we used in this experiment are listed in Table 2.

      2.8 Human pro-angiogenic antibody microarray

      1*106 fibroblasts were seeded in the 10 cm dish and incubated for 48 h at 37 °C to reach approximately 80% of confluence. Next, DMEM medium with 10% FBS was replaced by pure DMEM medium for 48 h. The supernatant was then collected and applied to the human proangiogenetic factors kit (Raybiotech, USA) as recommended by the manufacturer.

      2.9 Statistical analysis

      All data are expressed as mean ± S.E.M and analyzed with SPSS 26.0 software (SPSS Inc, Chicago, USA). Pearson's Chi-square test, unpaired t test, one-way ANOVA, and two-way ANOVA were used for statistical analysis. Values of P < 0.05 were considered statistically significant. P < 0.05 (*), P < 0.01 (**), P < 0.001(***)

      3. Results

      3.1 Angiogenesis was abnormally activated during laryngeal tumorigenesis

      As shown in Table 1, a total of 160 patients with vocal fold lesions were included in this study. IPCL patterns were evaluated by two otorhinolaryngologists and 1 endoscopist. The results confirmed that with histopathological progression, the IPCL grade increased (X2 = 26.247, P < 0.01). As shown in Fig. 1A, NBI imaging of vocal polyp rarely presented IPCL. It usually presented thin, oblique and branching vessels instead. VFL, especially severe dysplasia, showed irregular large brown spots on the surface of white plaque (Fig. 1D). Cancerization lesions exhibited large brown perpendicular dots or irregular, dilated, twisted worm-like vessels, appeared not only on the surface of the leukoplakia, but also on the mucosal surface around the white patch (Fig. 1E, F).
      Table 1Relationship between IPCL grades and pathological diagnosis.
      No (%)
      Pathological diagnosisnIPCL I-IIIPCL III-VI
      Laryngeal carcinoma8625 (29.07)61 (70.93)
      Vocal fold leukoplakia67
      High-grade dysplasia5417 (31.48)37 (68.52)
      Low-grade dysplasia1312 (92.31)1 (7.69)
      Vocal fold polyp76 (85.71)1 (14.29)
      Abbreviation: IPCL, intraepithelial papillary capillary loop.
      Table 2Primer sequences of RT-qPCR.
      GenesForwardReverse
      α-SMACTATGAGGGCTATGCCTTGCCGCTCAGCAGTAGTAACGAAGGA
      FAPGGAAGTGCCTGTTCCAGCAATGTGTCTGCCAGTCTTCCCTGAAG
      VimentinTGCCGTTGAAGCTGCTAACTACCAGAGGGAGTGAATCCAGATTA
      IL-6ACTCACCTCTTCAGAACGAATTGCCATCTTTGGAAGGTTCAGGTTG
      IL-8GATCCACAAGTCCTTGTTCCAGCTTCCACATGTCCTCACAA
      VEGFCCTTGCTGCTCTACCTCCACCTCCTCCTTCTGCCATGGG
      AngiogeninCAAGGCCATCTGTGAAAACAAGCAGGGGGAACCTCCATGTAG
      bFGFAGTGTGTGCTAACCGTTACCTACTGCCCAGTTCGTTTCAGTG
      HGFGCTATCGGGGTAAAGACCTACACGTAGCGTACCTCTGGATTGC
      GAPDHAACATCATCCCTGCCTCTACCCCTGTTGCTGTAGCCAAAT
      α-SMA indicates alpha-smooth muscle actin; FAP, fibroblast activation protein; IL-6, interleukin-6; IL-8, interleukin 8; VEGF, vascular endothelial growth factor; bFGF, basic fibroblast growth factor; HGF, hepatocyte growth factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
      Fig 1
      Fig. 1Angiogenesis was abnormally activated during laryngeal tumorigenesis. (A) NBI of vocal fold polyp revealed rarely IPCL. (B) Type II: IPCL and oblique branch vessel were invisible. (C) Type Ⅲ (small spot type): IPCL was visible in the form of small brown spots. (D)Type IV (large-spot mosaic type): The white plaque was thicker, and the tube diameter of IPCL increases and the density increases, which were irregularly shaped solid or hollow brown spots, and no abnormal spots were seen around the white patch. (E) Type Ⅴ (large spot surrounding type + large spot mixed type): the white spot was thicker, and the density increase, irregularly shaped solid or hollow brown IPCL can be seen on the surface of the white spot and around the white spot. (F) Type VI: Large brown spots or twisted earthworm-like vessels on the surface or outside of leukoplakia.

      3.2 Characterization of CAFs, LKAFs and NFs

      CAFs and VFLFs had a higher proportion of spindle and stellate cells. Immunofluorescence cytochemistry and rt-qPCR were applied to detect the expression of CAF markers. CAFs, VFLFs, and NFs exhibited positive staining for vimentin. Both CAFs and VFLFs expressed the myofibroblast markers FAP and α-SMA. NFs expressed α-SMA but not FAP. As shown in Fig. 2B, real-time PCR demonstrated that the expression levels of Vimentin, FAP and α-SMA in CAFs were higher than those of NFs, and the expression levels of Vimentin, FAP and α-SMA in VFLFs were higher than those in NFs. There was no significant difference between CAFs and VFLFs (P = 0.989, 0.292, 0.103).
      Fig 2
      Fig. 2Fibroblasts were activated during laryngeal tumorigenesis. (A) CAFs, VFLFs and NFs were immuno-stained with anti-FAP antibody and anti-α-SMA antibody. Nuclei were stained by DAPI. CAFs and VFLFs both exhibited Vimentin+/α-SMA+/FAP+ while NFs were shown Vimentin+/α-SMA+/FAP. (B) mRNA expression levels of Vimentin and CAF-specific genes, including α-SMA and FAP in CAFs, VFLFs and NFs were measured by rt-qPCR. The results were from three independent experiments and expressed as the mean ± standard deviation. **P < 0.01 and ***P < 0.001.

      3.3 CAF-CM and VFLF-CM promoted the proliferation and migration of HUVECs

      To shed light on whether CAFs, VFLFs, and NFs had different effects on proliferation in HUVECs, we performed CCK-8 assays. There was a statistically significant difference between the OD450 nm value of CAF-CM group and VFLF-CM group (P < 0.001), and the OD450 nm value of the two groups were both higher than those of NF-CM group (P < 0.001, Fig. 3A).
      Fig 3
      Fig. 3Spent culture supernatant from CAFs and VFLFs were able to promote HUVEC proliferation and migration.
      (A) CCK-8 assays were carried out to analyze the impact of fibroblast CM on HUVEC proliferation. The average absorbance of the CAF-CM group was 1.65, the VFLF-CM group was 1.56, and the NF-CM group was 0.88. CAF-CM and VFLF-CM significantly promoted HUVEC proliferation (P < 0.001). (B) Wound healing assays were used to investigate the impact of fibroblast CM on HUVEC migration. At 24h, CAF-CM and VFLF-CM significantly enhanced HUVECs wound closure rate compared with NF-CM. There was no significant difference between CAF-CM group and VFLF-CM group (P = 0.09). At 48h, VFLF-CM group exhibited higher wound closure rate compared with CAF-CM group and NF-CM group (P < 0.001). (C) Similar results were also observed in transwell experiments. The number of penetrating HUVECs treated with CAF-CM increased twofold compared with NF-CM group (P < 0.001) and 1.3 times compared with VFLF-CM group (P < 0.001).
      Migration is an important capability of the endothelial cell. Migration of endothelial cells is a vital prerequisite for tumor angiogenesis [
      • Lamalice L.
      • Le Boeuf F.
      • Huot J.
      Endothelial cell migration during angiogenesis.
      ]. Images of the scratch wound area at 0, 24, 48 h are shown in Fig. 3B. At 24 h, CAF-CM and VFLF-CM significantly enhanced the HUVEC wound closure rate compared to NF-CM (P < 0.001). There was no significant difference between CAF-CM group and VFLF-CM group (P = 0.09). At 48 h, VFLF-CM group exhibited a higher wound closure rate compared to the CAF-CM group and NF-CM group (P < 0.001). The migration ability of HUVECs was also determined by the transwell assay. The number of penetrating HUVEC treated with VFLF-CM increased 1.55 times compared with NF-CM group (P < 0.001). The results revealed that CAF-CM group and VFLF-CM group had a higher migration potential compared to NF-CM group (Fig. 3C). Therefore, we confirmed that CAFs and VFLFs could increase proliferation and migration in HUVECs.

      3.4 Enhanced tube formation capacity after co-culture with VFLFs

      In order to evaluate the capacity of tube formation induced by VFLFs, we performed Matrigel tube formation assay. As shown in Figure 4, the results suggested that the total branching length of HUVECs treated with VFLF-CM increased 1.74 times compared with NF-CM group (P < 0.001). No statistical differences were observed in total branching length between the CAF-CM group and the VFLF-CM group (P = 0.526). Similar results were observed in the number of nodes, junctions and total mesh areas.
      Fig 4
      Fig. 4Spent culture supernatant from CAFs and VFLFs were able to promote HUVEC tube formation.
      Tube formation capability of HUVECs cultivated for 4h in the CAF-CM, VFLF-CM and NF-CM.

      3.5 Profiling of proangiogenic secretome of CAFs, VFLFs, and NFs

      The antibody array detection results are shown in Fig. 5A. Concentrations of epidermal growth factor (EGF), heparin-binding EGF-like growth factor (HB-EGF) and Leptin were below the limit of detection (LOD). The concentrations of VEGF and angiogenin secreted by CAFs and VFLFs were significantly higher than those of NFs. Meanwhile, the concentrations of HGF and bFGF secreted by VFLF were significantly higher than those in CAF and NF. Next, we performed PCR to examine the mRNA expression level of pro-angiogenic factor. PCR results demonstrated that the mRNA expression levels of VEGF, HGF, bFGF, angiogenin, IL-6, IL-8, SDF1 in CAF were 3.47-, 9.80-, 1.20-, 1.62-, 7.14-, 9.76-, 6.96-fold higher than those of NF, and the expression levels of VEGF, HGF, bFGF, angiogenin, IL-6, IL-8, SDF1 of VFLFs were 1.53-, 7.35-, 2.77-, 2.35-, 1.48-, 9.05-, 3.22-fold higher than those of NFs (P < 0.05).
      Fig 5
      Fig. 5Pro-angiogenic secretome profiling of CAFs, VFLFs and NFs. (A) Concentration of the pro-angiogenic secretome of CAF-CM, VFLF-CM and NF-CM (pg/ml). (B) mRNA expression levels of pro-angiogenic factors in CAFs, VFLFs and NFs were measured by rt-qPCR. The results were from three independent experiments and expressed as the mean ± standard deviation. **P < 0.01 and ***P < 0.001.

      4. Discussion

      VFL has the characteristic features of local recurrence and malignant transformation. Alcohol, tobacco abuse and laryngopharyngeal reflux contribute to the formation of inflammatory microenvironment in VFL [
      • Fang Y.
      • Chen M.
      • Yang Y.
      • Chen J.
      • Cheng L.
      • He P.
      • et al.
      The variation of peripheral inflammatory markers in vocal leukoplakia before and after recurrence and canceration.
      ,
      • Chen M.
      • Chen J.
      • Yang Y.
      • Cheng L.
      • Wu H.
      Possible association between Helicobacter pylori infection and vocal fold leukoplakia.
      ]. Researchers have demonstrated that the rate of cancerous transformation inclined to increase with the grade of dysplasia. The rate of malignant transformation from moderate dysplasia to carcinoma in situ ranges from 14.3% to 75% [
      • Van Hulst A.M.
      • Kroon W.
      • van der Linden E.S.
      • Nagtzaam L.
      • Ottenhof S.R.
      • Wegner I.
      • et al.
      Grade of dysplasia and malignant transformation in adults with premalignant laryngeal lesions.
      ]. VFL is diagnosed mainly by laryngoscopy, especially the NBI mode. The presence of vocal fold hyperemia in VFL is a key indicator of its malignant potential. Our analysis of 160 NBI images revealed that with the pathology progression, the IPCL grade increased. There was a statistically significant difference between high-grade dysplasia VFL and low-grade dysplasia VFL (X2=15.791, P < 0.001). However, there was no significantly difference between vocal fold polyp and low-grade dysplasia VFL (X2=0.22, P = 0.639). There was also no discernible difference between the tumor group and high-grade dysplasia VFL group (X2=0.92, P = 0.762). The results demonstrated that the higher grade of IPCL suggested the higher possibility of malignancy and more severe neoangiogenic status. Although there have been a series of researches on the etiology, diagnosis and treatment of VFL, the underlying cellular and molecular mechanism of angiogenesis in VFL remains to be clarified.
      The tumor microenvironment, comprised of cancer cells, stroma cells, the extracellular matrix and cytokines, plays a vital role during the malignant transformation. Hypoxia, inflammation and immunosuppression are considered to be the major characteristics of the TME [
      • Wu T.
      • Dai Y.
      Tumor microenvironment and therapeutic response.
      ]. When stimulated by TGF-β, IL-6 and nuclear factor-kappaB (NF-κB), the normal fibroblasts differentiate into the activated fibroblast and express the CAF biomarkers, such as α-SMA, FAP and FSP1 [
      • Kalluri R.
      The biology and function of fibroblasts in cancer.
      ,
      • De Wever O.
      • Mareel M.
      Role of tissue stroma in cancer cell invasion.
      ]. CAFs are one of the major stromal cell types in the TME. They secrete various growth factors, cytokines to promote tumor progression, metastasis, angiogenesis and occurrence. CAFs in the stroma of head and neck squamous cell carcinoma has been of considerable interest to the otorhinolaryngology community in recent years [
      • Biffi G.
      • Tuveson D.A.
      Diversity and biology of cancer-associated fibroblasts.
      ]. However, the biological characterization of vocal fold leukoplakia fibroblasts has remained unclear. According to the results of our study, the stellate-shaped VFLFs expressed CAF markers Vimentin, α-SMA and FAP, indicating that VFL has existed CAFs. This is consistent with the opinion that “high-grade dysplasia leukoplakia can be considered as precancerous lesion”. Unexpectedly, the NFs expressed one of the CAF markers, α-SMA, which indicated that the NFs were partially activated.
      As we all known, angiogenetic switch is one of the hallmarks of cancer [
      • Hanahan D.
      • Weinberg R.A.
      Hallmarks of cancer: the next generation.
      ]. CAFs participate in tumor angiogenesis by releasing pro-angiogenic factors [
      • Kalluri R.
      The biology and function of fibroblasts in cancer.
      ]. Previous studies have unveiled that VEGF, IL-8, bFGF, and HGF are the key pro-angiogenic factors and cytokines during the process of angiogenesis in HNSCC [
      • Hasina R.
      • Whipple M.E.
      • Martin L.E.
      • Kuo W.P.
      • Ohno-Machado L.
      • Lingen M.W.
      Angiogenic heterogeneity in head and neck squamous cell carcinoma: biological and therapeutic implications.
      ]. Moreover, HGF, bFGF, and G-CSF were also considered as negative prognostic indicators in HNSCC [
      • Montag M.
      • Dyckhoff G.
      • Lohr J.
      • Helmke B.M.
      • Herrmann E.
      • Plinkert PK.
      Angiogenic growth factors in tissue homogenates of HNSCC: expression pattern, prognostic relevance, and interrelationships.
      ]. In OSCC, oral CAFs in tumor stroma play essential roles in the progression, angiogenesis, and lymphatic vessels formation [
      • Lin N.N.
      • Wang P.
      • Zhao D.
      • Zhang F.J.
      • Yang K.
      • Chen R.
      Significance of oral cancer-associated fibroblasts in angiogenesis, lymphangiogenesis, and tumor invasion in oral squamous cell carcinoma.
      ]. Our experiment data are the first to exhibit that VFLFs enhance angiogenesis by promoting proliferation, migration and tube formation capability of HUVECs compared with NFs. Furthermore, VFLFs even showed similar capacity for aiding tube formation compared to CAFs. Next, we evaluated the concentration of several common angiogenic factors, such as bFGF, HGF, ANG-2, HB-EGF, leptin, angiogenin, SDF1, PDGF-BB, EGF, PIGF, VEGF. The results demonstrated that VFLFs promoted angiogenesis by secreting VEGF, angiogenin, bFGF and HGF. Concentrations of HGF and bFGF secreted by VFLFs were even higher than those in CAFs.
      Inflammation is another notable characterization of cancer [
      • Hanahan D.
      • Weinberg R.A.
      Hallmarks of cancer: the next generation.
      ]. Chronic inflammation is closely related to tumor pathogenesis, development, and progression [
      • Bonomi M.
      • Patsias A.
      • Posner M.
      • Sikora A.
      The role of inflammation in head and neck cancer.
      ]. The expressions of Interleukin-8, Interleukin-6, Interleukin-1β and tumor necrosis factor-α (TNF-α) are higher in HNSCC patient specimens [
      • Chan L.P.
      • Liu C.
      • Chiang F.Y.
      • Wang L.F.
      • Lee K.W.
      • Chen W.T.
      • et al.
      IL-8 promotes inflammatory mediators and stimulates activation of p38 MAPK/ERK-NF-κB pathway and reduction of JNK in HNSCC.
      ]. It is also known in the literature that inflammation and angiogenesis influence and promote each other [
      • Coussens L.M.
      • Werb Z.
      Inflammation and cancer.
      ]. IL-6, a pleiotropic cytokine derived from tumor cells, CAFs, endothelial cells and tumor-infiltrating immune cells aids angiogenesis by activating the IL-6-STAT3-VEGFA signaling axis in hepatocellular carcinoma, breast cancer and cervical cancer, activating IL6-STAT3-HIF signaling in ovarian cell cancer [
      • Nagasaki T.
      • Hara M.
      • Nakanishi H.
      • Takahashi H.
      • Sato M.
      • Takeyama H.
      Interleukin-6 released by colon cancer-associated fibroblasts is critical for tumour angiogenesis: anti-interleukin-6 receptor antibody suppressed angiogenesis and inhibited tumour-stroma interaction.
      ,
      • Coussens L.M.
      • Werb Z.
      Inflammation and cancer.
      ,
      • Niu G.
      • Wright K.L.
      • Huang M.
      • Song L.
      • Haura E.
      • Turkson J.
      • et al.
      Constitutive Stat3 activity up-regulates VEGF expression and tumor angiogenesis.
      ,
      • Pan L.
      • Xiao H.
      • Liao R.
      • Chen Q.
      • Peng C.
      • Zhang Y.
      • et al.
      Fatty acid binding protein 5 promotes tumor angiogenesis and activates the IL6/STAT3/VEGFA pathway in hepatocellular carcinoma.
      ,
      • Wei L.H.
      • Kuo M.L.
      • Chen C.A.
      • Cheng W.F.
      • Cheng S.P.
      • Hsieh F.J.
      • et al.
      Interleukin-6 in cervical cancer: the relationship with vascular endothelial growth factor.
      ,
      • Anglesio M.S.
      • George J.
      • Kulbe H.
      • Friedlander M.
      • Rischin D.
      • Lemech C.
      • et al.
      IL6-STAT3-HIF signaling and therapeutic response to the angiogenesis inhibitor sunitinib in ovarian clear cell cancer.
      ]. IL-6 released by CAF facilitates tumor-stroma interaction and human colon cancer angiogenesis [
      • Nagasaki T.
      • Hara M.
      • Nakanishi H.
      • Takahashi H.
      • Sato M.
      • Takeyama H.
      Interleukin-6 released by colon cancer-associated fibroblasts is critical for tumour angiogenesis: anti-interleukin-6 receptor antibody suppressed angiogenesis and inhibited tumour-stroma interaction.
      ]. IL-8 has also been widely considered to be related to the regulation of tumor neo-angiogenesis [
      • Waugh D.J.
      • Wilson C.
      The interleukin-8 pathway in cancer.
      ,
      • Li A.
      • Varney M.L.
      • Valasek J.
      • Godfrey M.
      • Dave B.J.
      • Singh R.K.
      Autocrine role of interleukin-8 in induction of endothelial cell proliferation, survival, migration and MMP-2 production and angiogenesis.
      ,
      • Alfaro C.
      • Sanmamed M.F.
      • Rodríguez-Ruiz M.E.
      • Teijeira Á.
      • Oñate C.
      • González Á.
      • et al.
      Interleukin-8 in cancer pathogenesis, treatment and follow-up.
      ]. Our qPCR results demonstrated that the transcriptive level of IL-6 and IL-8 in VFLFs were significantly higher than those in NFs.
      The major limitation of this study is the mechanism by which VFLFs secrete more VEGF, angiogenin, bFGF, HGF than NFs remains unclear. Furthermore, since there is no animal model of VFL, this study cannot be verified at the animal level yet.

      5. Conclusions

      In summary, our work identified that with pathological progression, IPCL grade increased. VFLFs enhanced angiogenesis by promoting endothelial cells proliferation, migration, and tube formation, which provided a potential rationale for future studies on the role of fibroblast in VFL angiogenesis and malignant transformation. The pro-angiogenic factors evaluated in our study could provide a valuable resource for further basic and clinical research.

      Funding

      This work was supported by the Science and Technology Commission of Shanghai Municipality of China (Grant No. 20Y11901900, 22ZR1409800); and the Health and Family Planning Commission of Shanghai Municipality of China (Grant No. 2019SY059).

      Declaration of Competing Interest

      The authors declared that there was no conflict of interest.

      Acknowledgments

      We appreciate all the colleagues and patients who participated in this study. We would like to thank the reviewers and the editors for their comments.

      References

        • Isenberg J.S.
        • Crozier D.L.
        • Dailey S.H.
        Institutional and comprehensive review of laryngeal leukoplakia.
        Ann Otol Rhinol Laryngol. 2008; 117: 74-79https://doi.org/10.1177/000348940811700114
        • Gale N.
        • Poljak M.
        • Zidar N.
        Update from the 4th edition of the world health organization classification of head and neck tumours: what is new in the 2017 WHO blue book for tumours of the hypopharynx, larynx, trachea and parapharyngeal space.
        Head Neck Pathol. 2017; 11: 23-32https://doi.org/10.1007/s12105-017-0788-z
        • Van Hulst A.M.
        • Kroon W.
        • van der Linden E.S.
        • Nagtzaam L.
        • Ottenhof S.R.
        • Wegner I.
        • et al.
        Grade of dysplasia and malignant transformation in adults with premalignant laryngeal lesions.
        Head Neck. 2016; 38: 2284-2290https://doi.org/10.1002/hed.24185
        • Lee D.H.
        • Yoon T.M.
        • Lee J.K.
        • Lim S.C.
        Predictive factors of recurrence and malignant transformation in vocal cord leukoplakia.
        Eur Arch Otorhinolaryngol. 2015; 272: 1719-1724https://doi.org/10.1007/s00405-015-3587-8
        • Ni X.G.
        • Zhu J.Q.
        • Zhang Q.Q.
        • Zhang B.G.
        • Wang G.Q.
        Diagnosis of vocal cord leukoplakia: the role of a novel narrow band imaging endoscopic classification.
        Laryngoscope. 2019; 129: 429-434https://doi.org/10.1002/lary.27346
        • Ni X.G.
        • Wang G.Q.
        The role of narrow band imaging in head and neck cancer.
        Curr Oncol Rep. 2016; 18: 10https://doi.org/10.1007/s11912-015-0498-1
        • Hanahan D.
        • Folkman J.
        Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis.
        Cell. 1996; 86: 353-364https://doi.org/10.1016/s0092-8674(00)80108-7
        • Carmeliet P.
        • Jain R.K.
        Angiogenesis in cancer and other diseases.
        Nature. 2000; 407: 249-257https://doi.org/10.1038/35025220
        • Carmeliet P.
        • Jain R.K.
        Molecular mechanisms and clinical applications of angiogenesis.
        Nature. 2011; 473: 298-307https://doi.org/10.1038/nature10144
        • Arora S.
        • Kaur J.
        • Sharma C.
        • Mathur M.
        • Bahadur S.
        • Shukla N.K.
        • et al.
        Stromelysin 3, Ets-1, and vascular endothelial growth factor expression in oral precancerous and cancerous lesions: correlation with microvessel density, progression, and prognosis.
        Clin Cancer Res. 2005; 11: 2272-2284https://doi.org/10.1158/1078-0432.CCR-04-0572
        • Thiem D.G.E.
        • Schneider S.
        • Venkatraman N.T.
        • Kumar V.V.
        • Brieger J.
        • Frerich B.
        • et al.
        Semiquantifiable angiogenesis parameters in association with the malignant transformation of oral leukoplakia.
        J Oral Pathol Med. 2017; 46: 710-716https://doi.org/10.1111/jop.12544
        • Laitakari J.
        • Näyhä V.
        • Stenbäck F.
        Size, shape, structure, and direction of angiogenesis in laryngeal tumour development.
        J Clin Pathol. 2004; 57: 394-401https://doi.org/10.1136/jcp.2002.004978
        • Kalluri R.
        The biology and function of fibroblasts in cancer.
        Nat Rev Cancer. 2016; 16: 582-598https://doi.org/10.1038/nrc.2016.73
        • Fukumura D.
        • Xavier R.
        • Sugiura T.
        • Chen Y.
        • Park E.C.
        • Lu N.
        • et al.
        Tumor induction of VEGF promoter activity in stromal cells.
        Cell. 1998; 94: 715-725https://doi.org/10.1016/s0092-8674(00)81731-6
        • Huang B.
        • Huang M.
        • Li Q.
        Cancer-associated fibroblasts promote angiogenesis of hepatocellular carcinoma by -mediated pathway.
        Technol Cancer Res Treat. 2019; 18: 1-12https://doi.org/10.1177/1533033819879905
        • Liu Z.
        • Chen M.
        • Zhao R.
        • Huang Y.
        • Liu F.
        • Li B.
        • et al.
        CAF-induced placental growth factor facilitates neoangiogenesis in hepatocellular carcinoma.
        Acta Biochim Biophys Sin. 2020; 52 (Shanghai): 18-25https://doi.org/10.1093/abbs/gmz134
        • Orimo A.
        • Gupta P.B.
        • Sgroi D.C.
        • Arenzana-Seisdedos F.
        • Delaunay T.
        • Naeem R.
        • et al.
        Stromal fibroblasts present in invasive human breast carcinomas promote tumor growth and angiogenesis through elevated SDF-1/CXCL12 secretion.
        Cell. 2005; 121: 335-348https://doi.org/10.1016/j.cell.2005.02.034
        • Zhou B.
        • Zhuang X.M.
        • Wang Y.Y.
        • Lin Z.Y.
        • Zhang D.M.
        • Fan S.
        • et al.
        Tumor necrosis factor α induces myofibroblast differentiation in human tongue cancer and promotes invasiveness and angiogenesis via secretion of stromal cell-derived factor-1.
        Oral Oncol. 2015; 51: 1095-1102https://doi.org/10.1016/j.oraloncology.2015.08.017
        • Eiro N.
        • González L.
        • Martínez-Ordoñez A.
        • Fernandez-Garcia B.
        • González L.O.
        • Cid S.
        • et al.
        Cancer-associated fibroblasts affect breast cancer cell gene expression, invasion and angiogenesis.
        Cell Oncol. 2018; 41 (Dordr): 369-378https://doi.org/10.1007/s13402-018-0371-y
        • Mirkeshavarz M.
        • Ganjibakhsh M.
        • Aminishakib P.
        • Farzaneh P.
        • Mahdavi N.
        • Vakhshiteh F.
        • et al.
        Interleukin-6 secreted by oral cancer- associated fibroblast accelerated VEGF expression in tumor and stroma cells.
        Cell Mol Biol. 2017; 63 (Noisy-le-grand): 131-136https://doi.org/10.14715/cmb/2017.63.10.21
        • Ando N.
        • Hara M.
        • Shiga K.
        • Yanagita T.
        • Takasu K.
        • Nakai N.
        • et al.
        Eicosapentaenoic acid suppresses angiogenesis via reducing secretion of IL‑6 and VEGF from colon cancer‑associated fibroblasts.
        Oncol Rep. 2019; 42: 339-349https://doi.org/10.3892/or.2019.7141
        • Nagasaki T.
        • Hara M.
        • Nakanishi H.
        • Takahashi H.
        • Sato M.
        • Takeyama H.
        Interleukin-6 released by colon cancer-associated fibroblasts is critical for tumour angiogenesis: anti-interleukin-6 receptor antibody suppressed angiogenesis and inhibited tumour-stroma interaction.
        Br J Cancer. 2014; 110: 469-478https://doi.org/10.1038/bjc.2013.748
        • Lamalice L.
        • Le Boeuf F.
        • Huot J.
        Endothelial cell migration during angiogenesis.
        Circ Res. 2007; 100: 782-794https://doi.org/10.1161/01.RES.0000259593.07661.1e
        • Fang Y.
        • Chen M.
        • Yang Y.
        • Chen J.
        • Cheng L.
        • He P.
        • et al.
        The variation of peripheral inflammatory markers in vocal leukoplakia before and after recurrence and canceration.
        Dis Markers. 2020; 7241785https://doi.org/10.1155/2020/7241785
        • Chen M.
        • Chen J.
        • Yang Y.
        • Cheng L.
        • Wu H.
        Possible association between Helicobacter pylori infection and vocal fold leukoplakia.
        Head Neck. 2018; 40: 1498-1507https://doi.org/10.1002/hed.25121
        • Wu T.
        • Dai Y.
        Tumor microenvironment and therapeutic response.
        Cancer Lett. 2017; 387: 61-68https://doi.org/10.1016/j.canlet.2016.01.043
        • De Wever O.
        • Mareel M.
        Role of tissue stroma in cancer cell invasion.
        J Pathol. 2003; 200: 429-447https://doi.org/10.1002/path.1398
        • Biffi G.
        • Tuveson D.A.
        Diversity and biology of cancer-associated fibroblasts.
        Physiol Rev. 2021; 101: 147-176https://doi.org/10.1152/physrev.00048.2019
        • Hanahan D.
        • Weinberg R.A.
        Hallmarks of cancer: the next generation.
        Cell. 2011; 144: 646-674https://doi.org/10.1016/j.cell.2011.02.013
        • Hasina R.
        • Whipple M.E.
        • Martin L.E.
        • Kuo W.P.
        • Ohno-Machado L.
        • Lingen M.W.
        Angiogenic heterogeneity in head and neck squamous cell carcinoma: biological and therapeutic implications.
        Lab Invest. 2008; 88: 342-353https://doi.org/10.1038/labinvest.2008.6
        • Montag M.
        • Dyckhoff G.
        • Lohr J.
        • Helmke B.M.
        • Herrmann E.
        • Plinkert PK.
        Angiogenic growth factors in tissue homogenates of HNSCC: expression pattern, prognostic relevance, and interrelationships.
        Cancer Sci. 2009; 100: 1210-1218https://doi.org/10.1111/j.1349-7006.2009.01158.x
        • Lin N.N.
        • Wang P.
        • Zhao D.
        • Zhang F.J.
        • Yang K.
        • Chen R.
        Significance of oral cancer-associated fibroblasts in angiogenesis, lymphangiogenesis, and tumor invasion in oral squamous cell carcinoma.
        J Oral Pathol Med. 2017; 46: 21-30https://doi.org/10.1111/jop.12452
        • Bonomi M.
        • Patsias A.
        • Posner M.
        • Sikora A.
        The role of inflammation in head and neck cancer.
        Adv Exp Med Biol. 2014; 816: 107-127https://doi.org/10.1007/978-3-0348-0837-8_5
        • Chan L.P.
        • Liu C.
        • Chiang F.Y.
        • Wang L.F.
        • Lee K.W.
        • Chen W.T.
        • et al.
        IL-8 promotes inflammatory mediators and stimulates activation of p38 MAPK/ERK-NF-κB pathway and reduction of JNK in HNSCC.
        Oncotarget. 2017; 8: 56375-56388https://doi.org/10.18632/oncotarget.16914
        • Coussens L.M.
        • Werb Z.
        Inflammation and cancer.
        Nature. 2002; 420: 860-867https://doi.org/10.1038/nature01322
        • Coussens L.M.
        • Werb Z.
        Inflammation and cancer.
        Nature. 2002; 420: 860-867https://doi.org/10.1016/j.bbrc.2007.05.182
        • Niu G.
        • Wright K.L.
        • Huang M.
        • Song L.
        • Haura E.
        • Turkson J.
        • et al.
        Constitutive Stat3 activity up-regulates VEGF expression and tumor angiogenesis.
        Oncogene. 2002; 21: 2000-2008https://doi.org/10.1038/sj.onc.1205260
        • Pan L.
        • Xiao H.
        • Liao R.
        • Chen Q.
        • Peng C.
        • Zhang Y.
        • et al.
        Fatty acid binding protein 5 promotes tumor angiogenesis and activates the IL6/STAT3/VEGFA pathway in hepatocellular carcinoma.
        Biomed Pharmacother. 2018; 106: 68-76https://doi.org/10.1016/j.biopha.2018.06.040
        • Wei L.H.
        • Kuo M.L.
        • Chen C.A.
        • Cheng W.F.
        • Cheng S.P.
        • Hsieh F.J.
        • et al.
        Interleukin-6 in cervical cancer: the relationship with vascular endothelial growth factor.
        Gynecol Oncol. 2001; 82: 49-56https://doi.org/10.1006/gyno.2001.6235
        • Anglesio M.S.
        • George J.
        • Kulbe H.
        • Friedlander M.
        • Rischin D.
        • Lemech C.
        • et al.
        IL6-STAT3-HIF signaling and therapeutic response to the angiogenesis inhibitor sunitinib in ovarian clear cell cancer.
        Clin Cancer Res. 2011; 17: 2538-2548https://doi.org/10.1158/1078-0432.CCR-10-3314
        • Waugh D.J.
        • Wilson C.
        The interleukin-8 pathway in cancer.
        Clin Cancer Res. 2008; 14: 6735-6741https://doi.org/10.1158/1078-0432.CCR-07-4843
        • Li A.
        • Varney M.L.
        • Valasek J.
        • Godfrey M.
        • Dave B.J.
        • Singh R.K.
        Autocrine role of interleukin-8 in induction of endothelial cell proliferation, survival, migration and MMP-2 production and angiogenesis.
        Angiogenesis. 2005; 8: 63-71https://doi.org/10.1007/s10456-005-5208-4
        • Alfaro C.
        • Sanmamed M.F.
        • Rodríguez-Ruiz M.E.
        • Teijeira Á.
        • Oñate C.
        • González Á.
        • et al.
        Interleukin-8 in cancer pathogenesis, treatment and follow-up.
        Cancer Treat Rev. 2017; 60: 24-31https://doi.org/10.1016/j.ctrv.2017.08.004